Home India Indonesia Taiwan Kenya Thailand Vietnam
New Listings     Hot Listings     Top Rated     Editor Pick     Add a Listing      Upgrade a Listing     Update a Listing     Get Rated     Suggest a Category     Contact
+ Main Category

Crops: 6288
Biology: 168

+ Tell a Friend

Fill out the information below to email a friend a brief note about 'Olericulture: Vegetable Cultivation and Production'

Your Name:
     
Your Email:
     
Friend's Name:
     
Friend's Email:
     

     


+ Top 10


+ Directory Statistics


Links: 6596
Categories: 68
Registered Users: 104
Mailing List Subscribers: 25

+ Pagerank Statistics

PR 7
2 site(s)
PR 6
27 site(s)
PR 5
181 site(s)
PR 4
619 site(s)
PR 3
867 site(s)
PR 2
515 site(s)
PR 1
199 site(s)

+ Join Mailing List

Joining mailing list will entitle you to receive occasional emails informing you of news and updates to the site and any special offers that may be of interest to you.






ID-36: 2006-2007 Vegetable Production Guide for Commercial Growers.

12670 ID-36: 2006-2007 Vegetable Production Guide for Commercial Growers. http://www.ca.uky.edu/agc/pubs/id/id36/id36-02.pdf 24 Ferning out or feathering of the head of the asparagus spear indicates poor qual- ity with a high fiber content. Hightemperatureswillcause the tips of shoots to fern out at a shorter height. Crops > Asparagus > Research broadleaf   postemergence   control   back-to-back   non-selective   brussels   sprouts   perennial   grasses   disease   onset   chinese   cabbage   asparagus   lorsban Jan 1, 2006  

Write a Review   Add to My Favorite   Refer it to Friend   Report Broken Link  

Average Visitor Rating: 0.00 (out of 5)
Number of ratings: 0 Votes

Visitor Rating



Other links at Crops > Asparagus > Research

1062 / Molecular Plant-Microbe Interactions MPMI Vol. 19, No. 10, 2006, pp. 10621071. DOI: 10.1094/MPMI-19-1062. © 2006 The American Phytopathological Society REVIEW Priming: Getting Ready for Battle Prime-A-Plant Group: Uwe Conrath,1 Gerold J. M.
Category:

986 20 ACCCGAGATTGTTGGTTGAG 59.966 20 217 15 231 AGCTCAGTCCTCCACTTCCA 59.986 20 AATCGTTTGTAGCTGTCGGG 60.132 20 240 15 254 GGATTCCCAAACTCCGAAAT 60.131 20 ACCCGAGATTGTTGGTTGAG 59.966 20 140 92 231 >TA17352_4081 1 p1 (A)10 10 518 527 GGGCTTTTTGTGTAAAGGGTT 59.
Category:

Heritage Vegetable Garden Plant List: By Botanical Name Sort by Common Name Sort by Family Search all Plants Note: Only accessioned plants appear in this listing (perennial and woody plants). Name Common Name Family Name Aristolochia macrophylla DUTCHMAN'S PIPE PIPE VINE ARISTOLOCHIACEAE Asparagus
Category:

Rufen Sie bei akuten Vergiftungsfällen immer bei der Informationszentrale gegen Vergiftungen an. Sie erhalten 24 Stunden am Tag eine kostenlose Beratung. Für die Beantwortung von generellen Anfragen steht uns nur begrenzt Personal zur Verfügung.
Category:

0 INTRODUCTION 1 1.1 Background 1 1.2 Study Goals and Objectives 2 1.3 Study Area 3 2.0 METHODS 5 2.1 PFC Inventory and Assessment 5 2.2 Ecological Condition and Restoration Potential 7 2.3 Habitat Classification and Plant Associations 8 2.
Category:

Publication of a translation into another language is subject to the additional condition of prior approval from the relevant IUPAC National Adhering Organization.
Category:

Your browser does not support frames. Click here to view the unframed reprint.
Category:

officinalis L. GARDEN ASPARAGUS. Goat Island, Sept. 19, 1877 (J. D. Hooker's American Journal). "Goat Island and elsewhere. Not common," Day (1888). Ontario, Queen Victoria Park, Panton (1890). Ontario, Niagara Park System, Cameron (1895). "... in meadows or fence corners ...
Category:

Achyranthes bidentata (Amaranthaceae) Afzelia africana (Fabaceae) Alisma plantago-aquatica (Alismataceae) Amomum hochreutineri HIRSCHHORN, 1983 (Zingiberaceae) Anemarrhena asphodeloides (Liliaceae) Antidesma sp (Euphorbiaceae) Ardisia colorata ROXB.
Category:

2IRD/CIRAD Palm Biology Laboratory, UMR 1098, Centre IRD Montpellier, BP 64501, 911, Avenue Agropolis, 34394 Montpellier, France; 3CIRAD-AMIS, UMR 1098, Avenue Agropolis, 34398 Montpellier Cedex 5, France Received for publication December 9, 2004. Accepted for publication July 21, 2005. ABSTRACT
Category:





Valid XHTML 1.0 Transitional   Valid CSS