+ Main Category
+ Tell a Friend
Fill out the information below to email a friend a brief note about 'Olericulture: Vegetable Cultivation and Production'
+ Top 10
+ Directory Statistics
Links: 6596
Categories: 68
Registered Users: 104
Mailing List Subscribers: 25
+ Pagerank Statistics
+ Join Mailing List
Joining mailing list will entitle you
to receive occasional emails informing you of news and
updates to the site and any special offers that may be
of interest to you.
ID SSR nr. SSR type SSR size start end FORWARD PRIMER1 (5'-3') Tm(°C)...
12909
ID SSR nr. SSR type SSR size start end FORWARD PRIMER1 (5'-3') Tm(°C)...
http://www.tigr.org/tdb/sol/SSR/Solanum_lycopersicum_release_2.fasta.misa.results
986 20 ACCCGAGATTGTTGGTTGAG 59.966 20 217 15 231 AGCTCAGTCCTCCACTTCCA 59.986 20 AATCGTTTGTAGCTGTCGGG 60.132 20 240 15 254 GGATTCCCAAACTCCGAAAT 60.131 20 ACCCGAGATTGTTGGTTGAG 59.966 20 140 92 231 >TA17352_4081 1 p1 (A)10 10 518 527 GGGCTTTTTGTGTAAAGGGTT 59.
Crops > Asparagus > Research
mouse-ear cress arabidopsis thaliana lycopersicon esculentum common tobacco hypothetical protein oryza sativa nicotiana tabacum solanum
Jan 1, 2007
Write a Review
Add to My Favorite
Refer it to Friend
Report Broken Link
Other links at Crops > Asparagus > Research
1. Asparagus, Commercial Vegetable Production Guides, North Willamette Research and Extension Center.
The Commercial Vegetable Production Guides are a source of information on producing vegetables crops in the Pacific Northwest, particulary in Oregon. They include information on varieties, fertilizer applications, harvesting, handling, storage, pest control, and other cultural practices, as well as
Category:
2. Liliaceae.
Erythronium americanum, trout lily, in this location along a steep bank of the North River in Mount Crawford, Virginia, is clearly one of the most attractive members of the family, and always attracts attention of collectors and photographers.
Category:
After reviewing our references, no nutrient conposition was available. Asparagus should be an accept feed for ruminant animals as long as no insecticide or herbicide residues occur and little dirt contamination occurs. If the product was intented for human consumption, risk should be minimal.
Category:
Centro Interdipartimentale dell'Orto Botanico dell'Università degli Studi della Tuscia ; Tuscia Botanics Garden
Category:
Agronomic performance and genetic diversity of the root crop yam bean (Pachyrhizus spp.) under West African conditions / Ahissou Séraphin Zanklan. - Electronic edition.
Category:
6. Common Name.
italica Immature flower stalk Insect Cabbage Brassicaceae Brassica oleracea var. capitata Leaf Insect Carrot Apiaceae Daucus carota Root and leaf Insect Cauliflower Brassicaceae Brassica oleracea var.
Category:
Biodiversity of the Georges River Catchment: Terrestrial biodiversity I A - 1 I DIPNR I November 2004 Appendix A Literature and data review list Reports containing information about selected fauna species Don Fox Planning Pty Ltd (1994). Liverpool Rural Lands Study.
Category:
Exotic Plant Species Known to Occur on the Oak Ridge Reservation - May 1996 a Agrostemma githago Cynodon dactylon Ligustrum sinense Ranunculus acris Agrostis stolonifera Dactylis glomerata Ligustrum vulgate* (id) Ranunculus bulbosus Ailanthus altissima Datura stramonium Linaria vulgaris Ranunculus
Category:
9. Objective:.
TEXAS Houston Airport 11 Inspection Station 10 Maritime 5 SOUTH CAROLINA Charleston Maritime 3 Airport 8 CALIFORNIA total shipments: 200 Oakland Maritime 3 Los Angeles Airport 137 Inspection Station 2 Long Beach Maritime 58 FLORIDA total shipments: 162,673 Jacksonville Maritime 31 Orlando Ins.
Category:
