+ Main Category
+ Tell a Friend
Fill out the information below to email a friend a brief note about 'Olericulture: Vegetable Cultivation and Production'
+ Top 10
+ Directory Statistics
Links: 6600
Categories: 68
Registered Users: 108
Mailing List Subscribers: 25
+ Pagerank Statistics
+ Join Mailing List
Joining mailing list will entitle you
to receive occasional emails informing you of news and
updates to the site and any special offers that may be
of interest to you.
FSnet Feb.
15947
FSnet Feb.
http://archives.foodsafety.ksu.edu/fsnet/2005/2-2005/fsnet_feb_23-2.htm
Combined effects of coating, modified atmosphere packaging, and gamma irradiation on quality maintenance of ready-to-use carrots (Daucus carota) February 2005 Journal of Food Protection Volume 68, Number 2, p. 353-359 R. Lafortune ; S. Caillet ; M. Lacroix http://www.foodprotection.org/QuickLinks.
Crops > Carrot > Research
amoeba time-temperature integrators irradiation meat processing seafood products parasite pathogens genome sequence food dye
Jan 1, 2007
Write a Review
Add to My Favorite
Refer it to Friend
Report Broken Link
Other links at Crops > Carrot > Research
{Lycopersicon esculentum;} ^|^PIR|S42542|S42542 ripening-associated membrane protein (clone pNY507) - tomato {Lycopersicon esc-TRUNCATED- 1 p1 (A)12 12 161 172 CCACTATAAAACAACCACAACCC 59.569 23 GACAACTCCCCTGGTTCAAA 59.943 20 254 79 332 CCACTATAAAACAACCACAACCC 59.
Category:
ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, Oct. 2003, p. 32403246 Vol. 47, No. 10 0066-4804/03/$08.00 0 DOI: 10.1128/AAC.47.10.32403246.2003 Copyright © 2003, American Society for Microbiology. All Rights Reserved.
Category:
Origin and Distribution: Wild carrot is native to Europe. It entered the United States about 250 years ago, probably as a contaminant of cultivated carrot seeds, and was reported in Canada about 150 years later. It has since spread throughout most of North America.
Category:
June 10, 2003 Are you growing carrots in your nursery? For most of you, the answer is probably YES!. We are going to focus on 3 plants in the carrot family this week (some call it the parsley family).
Category:
English 402 Message Board http://www.pharmchemical.com Manufacturer of Pharmaceuticals, Chemicals, Intermediates, Steroids and Hormones, Anticancer Drugs, Herb Extract. etc......
Category:
Scientific identification: Abelmoschus esculentus Local name & other common names: Benda, Okra/Ladies Finger (English) Part(s) used: Vegetable Preparation: Unknown Nutrient Nutrient Composition/100g (edible portion) Vegetable Energy, Kcal 35 Protein, g 1.9 Fat, g 0.2 Carbohydrate, g 6.
Category:
Nitra, 2006 Dizerta
ná práca bola vypracovaná v externej forme doktorandského atúdia na Katedre skladovania a spracovania rastlinných produktov Fakulty biotechnológie a potravinárstva Slovenskej po>nohospodárskej univerzity v Nitre. Doktorand: Martina Fikselová, Ing.
ná práca bola vypracovaná v externej forme doktorandského atúdia na Katedre skladovania a spracovania rastlinných produktov Fakulty biotechnológie a potravinárstva Slovenskej po>nohospodárskej univerzity v Nitre. Doktorand: Martina Fikselová, Ing.
Category:
8. publication.
Publication Information Publication Name: Effect of temperature on the relationship between Orobanche spp. and carrot ( Daucus carota L Year Published: 2001 Journal: Crop Protection [Other H.U.Publications in
Category:
Heirloom Varieties: Golden Oldies in the Garden Presented by Joran Viers Bernalillo County Cooperative Extension Service Definitions What is an heirloom variety: An open-pollinated variety having some considerable ancestry and history of use. Definitions, cont.
Category:
Plants Names for Ethnobotany Project Final List By Linda Fendell Entry Common Names Scientific Names Family Name Species Name Family Name Species Name Horsetail Common Horsetail Equisetaceae Equisetum arvense L. Horsetail Common Horsetail Equisetaceae Equisetum telmatiea
Category:
