+ Main Category
+ Tell a Friend
Fill out the information below to email a friend a brief note about 'Olericulture: Vegetable Cultivation and Production'
+ Top 10
+ Directory Statistics
Links: 6601
Categories: 68
Registered Users: 120
Mailing List Subscribers: 26
+ Pagerank Statistics
+ Join Mailing List
Joining mailing list will entitle you
to receive occasional emails informing you of news and
updates to the site and any special offers that may be
of interest to you.
Epigenetic aspects of somaclonal variation in plants.
15956
Epigenetic aspects of somaclonal variation in plants.
http://www.biol.unlp.edu.ar/biotecnologiaorganismossuperiores/seminario1a.pdf
Plant Molecular Biology 43: 179188, 2000. M.A. Matzke and A.J.M. Matzke (Eds.), Plant Gene Silencing. © 2000 Kluwer Academic Publishers. Printed in the Netherlands. 179 Epigenetic aspects of somaclonal variation in plants Shawn M. Kaeppler, Heidi F.
Crops > Carrot > Research
somaclonal variation methylation epigenetic dna chromosome breakage regenerated plants progeny mutants silencing
Jan 1, 2006
Write a Review
Add to My Favorite
Refer it to Friend
Report Broken Link
Other links at Crops > Carrot > Research
Information about the Plant reproduction and Speciation Group based at the University of Bristol, UK.
Category:
{Lycopersicon esculentum;} ^|^PIR|S42542|S42542 ripening-associated membrane protein (clone pNY507) - tomato {Lycopersicon esc-TRUNCATED- 1 p1 (A)12 12 161 172 CCACTATAAAACAACCACAACCC 59.569 23 GACAACTCCCCTGGTTCAAA 59.943 20 254 79 332 CCACTATAAAACAACCACAACCC 59.
Category:
This area of the National Biological Information Infrastructure (NBII) conceptualizes, organizes, and displays a wide range of biological information from geographical and geospatial perspectives.
Category:
Being sick of big city life drove me to rural Nova Scotia where I got back down to earth so-to-speak to pursue a M.Sc. in sustainable agriculture through Dalhousie University.
Category:
*Information from Swearingen, J. 2006. WeedUS database, Alien Plant Invaders of Natural Areas. Plant Conservation Alliance, Alien Plant Working Group. http://www.nps.gov/plants/alien/list/WeedUS.
Category:
Complete list of plant and animal remains recorded from samples from North Bridge, Doncaster, in taxonomic order.................................................. A1 Table 2.
Category:
The Open Book page image presentation framework is not designed to replace printed books. Rather, it is a free, browsable, nonproprietary, fully and deeply searchable version of the publication which we can inexpensively and quickly produce to make the material available worldwide.
Category:
Essential component of cell cytoskeleton; plays an important role in cytoplasmic streaming, cell shape determination, cell division, organelle movement and extension growth.
Category:
This list last updated July 19, 2002 Note: Assembly 1 was done on Jan 29, 2001. Assembly 2 was done on April 1, 2002. \N indicates that the EST is a singleton.
Category:
Calcium channels have been suggested to play a major role in the initiation of a large number of signal transduction processes in higher plant cells. However, molecular components of higher plant Ca2+ channels remain unidentified to date.
Category:
