+ Main Category
+ Tell a Friend
Fill out the information below to email a friend a brief note about 'Olericulture: Vegetable Cultivation and Production'
+ Top 10
+ Directory Statistics
Links: 6596
Categories: 68
Registered Users: 85
Mailing List Subscribers: 19
+ Pagerank Statistics
+ Join Mailing List
Joining mailing list will entitle you
to receive occasional emails informing you of news and
updates to the site and any special offers that may be
of interest to you.
View entire record back to category listing new search scientific...
16422
View entire record back to category listing new search scientific...
http://www.herbmed.org/members/serv/bridgeport/default.asp?getpg=http://www.herbmed.org/members/HerbTemplates/subcategory.asp?varSubcategory_ID=14&varHerb_ID=209
Investigation on dissipation of alachlor in cotton plant, soil and water and its bioaccumulation in fish shows that the green leafy vegetable samples like Coriandrum sativum and edible amaranth did not show any toxic symptoms of alachlor residues.
Crops > Carrot > Research
coriander oil composition giardia cysts petroselinic acid daucus carota l expression of arabidopsis ascaris essential vegetable samples
Jan 1, 2007
Write a Review
Add to My Favorite
Refer it to Friend
Report Broken Link
Other links at Crops > Carrot > Research
FHWA/IN/JTRP-2000/17 Final Report New Treatment Combinations for Vegetation Management Along Indiana Roadsides D. James Morré December 2000 FHWA/IN/JTRP-2000/17 Final Report New Treatment Combinations for Vegetation Management Along Indiana Roadsides D.
Category:
2. Forord.
01. april 2006. For at imødekomme behovet hos såvel danske som udenlandske læsere er der medtaget 2 indholds- fortegnelser, der adskiller sig ved, at fortegnelsen over arterne er opstillet alfabetisk efter henholdsvis latinsk og dansk navn.
Category:
The formin family of proteins has been implicated in signaling pathways of cellular morphogenesis in both animals and fungi; in the latter case, at least, they participate in communication between the actin cytoskeleton and the cell surface.
Category:
This study was conducted at the Michigan State University Muck Soils Research Farm in Laingsburg, MI on a Houghton muck field previously planted to carrot. Bolero carrot seed s were planted at a density of 22.
Category:
Single Seed Raman Measurements Allow Taxonomical Discrimination of Apiaceae Accessions Collected in Gene Banks R. Baranski1,2 M. Baranska3,4 H. Schulz3 P. W. Simon5 T.
Category:
{Lycopersicon esculentum;} ^|^PIR|S42542|S42542 ripening-associated membrane protein (clone pNY507) - tomato {Lycopersicon esc-TRUNCATED- 1 p1 (A)12 12 161 172 CCACTATAAAACAACCACAACCC 59.569 23 GACAACTCCCCTGGTTCAAA 59.943 20 254 79 332 CCACTATAAAACAACCACAACCC 59.
Category:
ScienceDirect - the world's leading platform offers over 2,000 high quality peer-reviewed full-text journals and books on science, technology and medicine.
Category:
OG Mitochondrion OX NCBI_TaxID=4039; XX FH Key Location/Qualifiers FH FT source 1..786 FT /organism="Daucus carota" FT /organelle="mitochondrion" FT /strain="ssp.
Category:
factormedian_fitted_datamedian_fitted_datagene annotationgene annotation condition1condition0(CONTROL)condition1functional categorydescription VBVHG06?
Category:
10. Plant Names.
Hordeum vulgare Phaseolus sp. Andropogon sp. Kochia scoparia Andropogon gerardi Sarcobatus vermiculatus Lesquerella sp.
Category:
