+ Main Category
+ Tell a Friend
Fill out the information below to email a friend a brief note about 'Olericulture: Vegetable Cultivation and Production'
+ Top 10
+ Directory Statistics
Links: 6600
Categories: 68
Registered Users: 108
Mailing List Subscribers: 25
+ Pagerank Statistics
+ Join Mailing List
Joining mailing list will entitle you
to receive occasional emails informing you of news and
updates to the site and any special offers that may be
of interest to you.
Terhi Suojala: Pre- and postharvest development of carrot yield and quality.
16654
Terhi Suojala: Pre- and postharvest development of carrot yield and quality.
http://ethesis.helsinki.fi/julkaisut/maa/kastu/vk/suojala/references.html
Alabran, D.M. & Mabrouk, A.F. 1973. Carrot flavour, sugars and free nitrogenous compounds in fresh carrots. Journal of Agricultural and Food Chemistry 21: 205-208. Apeland, J. 1974. Storage quality of carrots after different methods of harvesting. Acta Horticulturae 38: 353-357.
Crops > Carrot > Research
daucus carota l carrot root horticultural storage botrytis cinerea effects of different fertilization practices food research international sensory quality
Jan 1, 2000
Write a Review
Add to My Favorite
Refer it to Friend
Report Broken Link
Other links at Crops > Carrot > Research
1 Peru's List LIST OF GOODS APPENDIX 1 1 Subheading Description Base Rate Basket 1.
Category:
Department of Chemical and Biological Sciences, Japan Women's University, Tokyo, Japan. Previously, we cloned a carrot (Daucus carota L.) cDNA encoding a 45-kD protein, 21D7, located in the nuclei of proliferating cells.
Category:
Reproduction of this publication for resale or other commercial purposes is prohibited without the prior written permission of the copyright holder. ISBN: 2-8317-0640-8 Cover photos by: Jaroslav Ungerman Rūta Vačiūnaitė Grzegorz and Tomasz K³osowscy DTP: W-TEAM; Marek J.
Category:
4. Appendix a.
Approximately 25% of the species have not been relocated, and are presumed to have disappeared from the property.
Category:
Australian Water Conservation and Reuse Research Program Impacts on soil, groundwater and surface water from continued irrigation of food and turf crops with water reclaimed from sewage. Daryl Stevens3 , Murray Unkovich1 , Jim Kelly3 , Guang- GouYing2 .
Category:
Carrot - Daucus carota - has been used to encourage delayed menstruation, and can induce uterine contractions in pregnant women.
Category:
7. Sįī~h.
0 11.5h~h-Ķ,²÷ 56 39 27 8 1.0 1.0'’ S 56 39 23 8 5.9 4.5^ R 60 53 48 8 12.8 8.8qf RR 61 82 80 8 13.0 12.
Category:
{Lycopersicon esculentum;} ^|^PIR|S42542|S42542 ripening-associated membrane protein (clone pNY507) - tomato {Lycopersicon esc-TRUNCATED- 1 p1 (A)12 12 161 172 CCACTATAAAACAACCACAACCC 59.569 23 GACAACTCCCCTGGTTCAAA 59.943 20 254 79 332 CCACTATAAAACAACCACAACCC 59.
Category:
Research project: Chemical ecology and dispersal of the carrot psyllid, Trioza apicalis, Pheromone group, Ecology Department, Lund University, Sweden
Category:
10. 3.pdf.
Ethnobotanical Uses of Illinois River Basin Plants 223 Appendix 3 Ethnobotanical Uses of Illinois River Basin Plants " Rosehips (Rosa acicularis) were often gathered after the first frost in the fall. These stay on the bush in the winter can be stored for use as an emergency food.
Category:
