Home India Indonesia Taiwan Kenya Thailand Vietnam
New Listings     Hot Listings     Top Rated     Editor Pick     Add a Listing      Upgrade a Listing     Update a Listing     Get Rated     Suggest a Category     Contact
+ Main Category

Crops: 6288
Biology: 168

+ Tell a Friend

Fill out the information below to email a friend a brief note about 'Olericulture: Vegetable Cultivation and Production'

Your Name:
     
Your Email:
     
Friend's Name:
     
Friend's Email:
     

     


+ Top 10


+ Directory Statistics


Links: 6598
Categories: 68
Registered Users: 104
Mailing List Subscribers: 25

+ Pagerank Statistics

PR 7
2 site(s)
PR 6
27 site(s)
PR 5
178 site(s)
PR 4
620 site(s)
PR 3
872 site(s)
PR 2
510 site(s)
PR 1
200 site(s)

+ Join Mailing List

Joining mailing list will entitle you to receive occasional emails informing you of news and updates to the site and any special offers that may be of interest to you.






ID SSR nr. SSR type SSR size start end FORWARD PRIMER1 (5'-3') Tm(°C)...

17714 ID SSR nr. SSR type SSR size start end FORWARD PRIMER1 (5'-3') Tm(°C)... http://www.tigr.org/tdb/sol/SSR/Nicotiana_tabacum_release_2.fasta.misa.results 172 22 AAAGCTCTTCATGGGAGCAA 59.955 20 228 4 231 GCGGGACACAGAACTTCTTTAC 60.172 22 GGAGCAACACCCTGAATGAT 59.934 20 215 4 218 GCGGGACACAGAACTTCTTTAC 60.172 22 ACATTTGCAGCCATTTCCTC 60. Crops > Chili pepper > Research mouse-ear   cress   arabidopsis   thaliana   common   tobacco   nicotiana   tabacum   hypothetical   protein   oryza   sativa   japonica Jan 1, 2007  

Write a Review   Add to My Favorite   Refer it to Friend   Report Broken Link  

Average Visitor Rating: 0.00 (out of 5)
Number of ratings: 0 Votes

Visitor Rating



Other links at Crops > Chili pepper > Research

To clone and characterize urocortin gene expression in the pig using molecular biology techniques to be developed for use at the University of Maryland Eastern Shore (UMES) with collaborators at Pennsylvania State University
Category:

We tried the hot-pepper stuff once, to keep the squirrly critters from digging in our potted plants. They dug more! -S.P.McCool / http://www.swamphen.net/ Crawfordville, Florida, USA - Wakulla County 30.166ºN 84.402ºW - elv.
Category:

Low dose intravenous orphenadrine citrate (30 mg) was able to exert an analgesic/ anti-hyperalgesic effect predominantly due to central/spinal mechanisms in capsaicin model of 18 healthy volunteers, with laser somatosensory evoked potentials.
Category:

Lizbeth López-Carrillo, Ph.D.(1) Ma. del Cielo Fernández-Ortega, Lic. en Nut.(1) Roberta Costa-Dias, M. en C.(1) Jesús Franco-Marina, Lic. en Inf.(1) Tito Alejandre-Badillo, T.S.
Category:

CV of Dr. Shafqat Saeed Assistant Professor of Entomology E-mail: bombus@bzumail.edu.pk shafqatsaeed@yahoo.com Qualification Ph.D Agri. Entomology Kyungpook National University Taegu, S. Korea M.Sc (Hons.) Agri. Agri. Entomology University of Agriculture Faisalabad, Pakistan B.Sc (Hons.)Agri. Agri.
Category:

2008 VOC & NOx Target Levels VOC Target Level for 2008 Milestone Baltimore Nonattainment Area Emissions in Tons per Day Formula A 2002 Base Year Inventory 494.68 B Biogenic Emissions 223.20 C2002 Rate-of Progress Base Year Inventory A - B 271.48 D FMVCP/RVP Reductions Between 2002 and 2008 9.
Category:

distichon) 'Malt' barley - very young seedlings are dried to produce malt which contains enzymes that convert starch to sugars.
Category:

This report was developed with the contributi This report was developed with the contribution of Rémy HUGON - Attaché à la Direction Scientifique CIRAD-FLHOR (1) (1) CIRAD-FLHOR, B.P.
Category:

Scientific Name Common Name Abelmoschus esculentus 'Burgundy' Burgundy Okra Abutilon 'Christina' Christina Flowering Maple Abutilon grandifolium Flowering maple Abutilon 'La Vie En Rose' La Vie En Rose Flowering Maple Abutilon 'Moonchimes' Moonchimes Flowering Maple Abutilon 'Satin Pink
Category:

bstract This paper explores the chemical structure and function of capsaicin, the active chemical ingredient responsible for the spicy burning sensation of chili peppers.
Category:





Valid XHTML 1.0 Transitional   Valid CSS