Home India Indonesia Taiwan Kenya Thailand Vietnam
New Listings     Hot Listings     Top Rated     Editor Pick     Add a Listing      Upgrade a Listing     Update a Listing     Get Rated     Suggest a Category     Contact
+ Main Category

Crops: 6288
Biology: 168

+ Tell a Friend

Fill out the information below to email a friend a brief note about 'Olericulture: Vegetable Cultivation and Production'

Your Name:
     
Your Email:
     
Friend's Name:
     
Friend's Email:
     

     


+ Top 10


+ Directory Statistics


Links: 6596
Categories: 68
Registered Users: 83
Mailing List Subscribers: 18

+ Pagerank Statistics

PR 7
1 site(s)
PR 6
37 site(s)
PR 5
184 site(s)
PR 4
626 site(s)
PR 3
921 site(s)
PR 2
518 site(s)
PR 1
161 site(s)

+ Join Mailing List

Joining mailing list will entitle you to receive occasional emails informing you of news and updates to the site and any special offers that may be of interest to you.




Web Links [Tag : arabidopsis]


Sort By :
ERF/AP2IDS1Zea mays indeterminate spikelet1 (ids1) AF048900 PUT-151a-Zea_mays-101615 11669.m06144 MZ00027885 MZ00040412 1.
Details Hits: 0 Votes: 0 Ratings: Reviews: Google PR:

62. Gcd.
C7C1_ARATH (O64636) Cytochrome P450 76C1 (EC 1.14.-.-) 0 897 466/512 512 C7C2_ARATH (O64637) Cytochrome P450 76C2 (EC 1.14.-.-) 0 694 352/463 463 C7C4_ARATH (O64635) Cytochrome P450 76C4 (EC 1.14.-.-) 0 682 350/509 509 C76C4_ARATH (O64635) Cytochrome P450 76C4 (EC 1.14.-.
Details Hits: 0 Votes: 0 Ratings: Reviews: Google PR:

We have devised a simple and efficient cDNA cloning strategy that overcomes many of the difficulties encountered in obtaining full-length cDNA clones of low-abundance mRNAs.
Details Hits: 0 Votes: 0 Ratings: Reviews: Google PR:

Indica 419 - 463 Oryza sativa ssp. Javanica 424 Citrullus vulgaris (= lanatus) 425 - 434 Mangifera indica 439 Ananas bracteatus 444 Cucumis melo 454 - 502 Medicago truncatula 454 - 526 Trifolium pratense 468 Brassica nigra 468 Brassica campestris ssp.
Details Hits: 0 Votes: 0 Ratings: Reviews: Google PR:

986 20 ACCCGAGATTGTTGGTTGAG 59.966 20 217 15 231 AGCTCAGTCCTCCACTTCCA 59.986 20 AATCGTTTGTAGCTGTCGGG 60.132 20 240 15 254 GGATTCCCAAACTCCGAAAT 60.131 20 ACCCGAGATTGTTGGTTGAG 59.966 20 140 92 231 >TA17352_4081 1 p1 (A)10 10 518 527 GGGCTTTTTGTGTAAAGGGTT 59.
Details Hits: 0 Votes: 0 Ratings: Reviews: Google PR:

66. Name.
Name GenBank AC Category Similarity Species Blast AC E value Seq quality Sma/Eco site polyA Seq length cDNA length rA05 BI978233 N No hits found y y 376 600 rA06 BI978234 N No hits found y n 722 1100 rA07 BI978235 U not annotated Arabidopsis thaliana AB006697 7,00E-05 y n 460 800 rA08 BI978236 N No
Details Hits: 0 Votes: 0 Ratings: Reviews: Google PR:

PENEL, professeur titulaire et directeur de these (Departement de botanique et biologie vegetale), Ch. DUNAND. docteur et co-directeur de these (Departement de botanique et biologie vegetale), L.
Details Hits: 0 Votes: 0 Ratings: Reviews: Google PR:

BLASTX 2.2.2 [Dec-14-2001] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402.
Details Hits: 1 Votes: 0 Ratings: Reviews: Google PR:

Probe Set AGI Data Source Criterion for Match TIGR Description 13254_at AT4G17190 TIGR ATH1.seq 100 percent over >= 50 bp, unique. farnesyl pyrophosphate synthetase 2 (FPS2) [farnesyl diphosphate synthase 2] / identical to GB:46350; supported by cDNA: gi_1146162_gb_L46349.
Details Hits: 0 Votes: 0 Ratings: Reviews: Google PR:

API61AA451580AA451580 nbspsimilar to GP|4038717|dbj|BAA35175.1||AB020956 ribulose-1,5-bisphosphate carboxylase/oxygenase small subunit {Triticum turgidum subsp.
Details Hits: 0 Votes: 0 Ratings: Reviews: Google PR:

Hypersensitive Response cysteine proteinase (EC 3.4.22.-) 3 precursor-kidney bean Hypersensitive Response cysteine proteinase (EC 3.4.22.-) precursor - spring vetch Hypersensitive Response cysteine proteinase (EC 3.4.22.-) F23E12.
Details Hits: 0 Votes: 0 Ratings: Reviews: Google PR:

uni-hamburg.de) Keywords Reproduction, female gametophyte, fertilization, cell-cell communication, signal peptide, genomics 1. INTRODUCTION In animal systems, cell-cell communications are mainly mediated by signals such as steroids and peptides.
Details Hits: 0 Votes: 0 Ratings: Reviews: Google PR:

array_element_name array_element_type organism is_control locus description is_ambiguous chromosome start stop 18001_at oligonucleotide Arabidopsis thaliana no AT1G01040 DEAD/DEAH box helicase carpel factory / CAF identical to RNA helicase/RNAseIII CAF protein GB:AAF03534 GI:6102610 from
Details Hits: 0 Votes: 0 Ratings: Reviews: Google PR:

74. Lends.
BLASTP 2.0.10 [Aug-26-1999] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402.
Details Hits: 0 Votes: 0 Ratings: Reviews: Google PR:

albert@nhm.uio.no; Douglas E Soltis - dsoltis@botany.ufl.edu; John E Carlson - jec16@psu.edu; William G Farmerie - wgf@biotech.
Details Hits: 0 Votes: 0 Ratings: Reviews: Google PR:

ACTA BIOLOGICA CRACOVIENSIA Series Botanica 45/2: 145152, 2003 REGENERATION OF DIPLOID AND TETRAPLOID PLANTS OF ARABIDOPSIS THALIANA VIA CALLUS ALICJA FRAS* AND JOLANTA MALUSZYNSKA Department of Plant Anatomy and Cytology, University of Silesia, ul.
Details Hits: 0 Votes: 0 Ratings: Reviews: Google PR:

gi|18265391|gb|AAL67159.1|AF323993_1 histone H3.3 [Trichinella p... 263 2e-69 gi|17567723|ref|NP_509344.1| Core histone H2A/H2B/H3/H4 (15.3 kD... 263 2e-69 gi|12847552|dbj|BAB27616.1| unnamed protein product [Mus musculus] 191 2e-69 gi|27718971|ref|XP_235304.1| similar to H3 histone, family 3B [R...
Details Hits: 0 Votes: 0 Ratings: Reviews: Google PR:

BLASTX 2.2.4 [Aug-26-2002] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402.
Details Hits: 0 Votes: 0 Ratings: Reviews: Google PR:

ENORMOUS GENOMIC RESOURCES have been developed for model plants such as Arabidopsis thaliana (L.) Heynh. and rice (Oryza sativa L.), including detailed genetic maps (Harushima et al., 1998), huge numbers of expressed sequence tags (ESTs) (Sasaki et al., 1994; Seki et al.
Details Hits: 0 Votes: 0 Ratings: Reviews: Google PR:

First published online October 13, 2006; 10.1104/pp.106.087965 Plant Physiology 142:1664-1682 (2006) © 2006 American Society of Plant Biologists
Details Hits: 0 Votes: 0 Ratings: Reviews: Google PR:

Pages: [< Previous] 1 2 3 4 5 6 [Next >]



Valid XHTML 1.0 Transitional   Valid CSS