+ Main Category
+ Tell a Friend
Fill out the information below to email a friend a brief note about 'Olericulture: Vegetable Cultivation and Production'
+ Top 10
+ Directory Statistics
Links: 6596
Categories: 68
Registered Users: 104
Mailing List Subscribers: 25
+ Pagerank Statistics
+ Join Mailing List
Joining mailing list will entitle you
to receive occasional emails informing you of news and
updates to the site and any special offers that may be
of interest to you.
Web Links [Tag : nicotiana]
Genome consists of RNA; single-stranded; linear. Total genome size 6.5 kb. Genome unipartite; largest (or only) genome part 6.5 kb. Genomic nucleic acid isolated by Alonso et al. (1991). Infectivity retained when deproteinised with phenol or detergent. Additional factor not required for infectivity.
Details Hits: 1 Votes: 0 Ratings: 
Reviews: 
Google PR: Description of 00.071.0.01.006. Paprika mild mottle virus, generated from ICTVdB, a DELTA database
Details Hits: 0 Votes: 0 Ratings: Reviews: Google PR: * Arabidopsis sp. * Brassica oleracea * Brassica alba * B. juncea * B. oleracea botrytis cauliflora * B. chinensis * B. rapa * Nicotiana benthamiana * N. edwardsonii * N.
Details Hits: 2 Votes: 0 Ratings: Reviews: Google PR: Description of 00.078.0.01.001. Carrot mottle virus, generated from ICTVdB, a DELTA database
Details Hits: 0 Votes: 0 Ratings: Reviews: Google PR: Description of 00.078.0.01.003.00.001. Carrot mottle mimic virus, type isolate, generated from ICTVdB, a DELTA database
Details Hits: 0 Votes: 0 Ratings: Reviews: Google PR: 6. No Job Name.
This review offers a brief overview of the field of microbial and plant biocatalysts, discusses the studies thus far on the use of intact plant materials for conducting synthetic chemical reactions, and considers some opportunities for future development.
Details Hits: 0 Votes: 0 Ratings: Reviews: Google PR: 00: gb|AAM81202.1| calmodulin 1 [Medicago truncatula] gb|AAD53313.1| calmodulin 7 [Arabidopsis thaliana] emb|CAH57707.1| calmodulin [Quercus petraea] gb|AAM66013.1| calmodulin 7 [Arabidopsis thaliana] emb|CAA43143.1| Calmodulin [Malus x domestica] emb|CAB83153.
Details Hits: 0 Votes: 0 Ratings: Reviews: Google PR: Arabinogalactan-proteins: structure, expression and function A. M. Showalter Department of Environmental and Plant Biology, Molecular and Cellular Biology Program, Ohio University, Athens, Ohio 45701-2979 (USA), Fax +1 740 593 1130, e-mail: showalte@ohio.edu Abstract.
Details Hits: 0 Votes: 0 Ratings: Reviews: Google PR: Query sequence: S39K5 (611 letters) Database: ./db/nr 2,304,535 sequences; 784,226,776 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gb|AAM81202.1| calmodulin 1 [Medicago truncatula] >gi|5825598|gb...
Details Hits: 0 Votes: 0 Ratings: Reviews: Google PR: !!SEQUENCE_LIST 1.0 (Peptide) FASTA of: seq.seq from: 1 to: 383 February 19, 1999 15:06 REFORMAT of: seq.seq check: 4199 from: 1 to: 383 February 19, 1999 15:04 (No documentation) TO: SwissProt:* Sequences: 71,248 Symbols: 25,831,459 Word Size: 2 Databases searched: SWISS-PROT, Release 35.
Details Hits: 0 Votes: 0 Ratings: Reviews: Google PR: BSTRACT ELLIOTT, PATSY ELIZABETH. Screening tobacco germplasm for resistance to diseases affecting transplant production. (Under the direction of Jennifer S. Levin.) Rhizoctonia solani causes stem rot and target spot of greenhouse-produced tobacco seedlings.
Details Hits: 0 Votes: 0 Ratings: Reviews: Google PR: {Lycopersicon esculentum;} ^|^PIR|S42542|S42542 ripening-associated membrane protein (clone pNY507) - tomato {Lycopersicon esc-TRUNCATED- 1 p1 (A)12 12 161 172 CCACTATAAAACAACCACAACCC 59.569 23 GACAACTCCCCTGGTTCAAA 59.943 20 254 79 332 CCACTATAAAACAACCACAACCC 59.
Details Hits: 0 Votes: 0 Ratings: Reviews: Google PR: 103e-277 T20O9TF : Page 1 of HTML SIMILAR TO: gi|2351072|dbj|AB006707|AB006707 Arabidopsis thaliana genomicDNA, chromosome 5, P1 clone: MYC6 PVALUE: 6.
Details Hits: 0 Votes: 0 Ratings: Reviews: Google PR: AC: RSP00001//OS: tomato (Lycopersicon esculentum) /GENE: pds/RE: Pds/Le element /BF: unknown nuclear factor 2. AC: RSP00002//OS: Brassica napus /GENE: Oleosin/RE: ABRE-3 /BF: B.napus embryo protein factor 3.
Details Hits: 0 Votes: 0 Ratings: Reviews: Google PR: 15. dbEST Summary.
(rat) 871,163 Ciona intestinalis 686,396 Xenopus laevis (African clawed frog) 677,784 Sus scrofa (pig) 641,896 Gallus gallus (chicken) 599,330 Drosophila melanogaster (fruit fly) 532,557 Hordeum vulgare + subsp.
Details Hits: 0 Votes: 0 Ratings: Reviews: Google PR: S 11 0 1409 Bacillus sphaericus S 11 0 1421 Bacillus stearothermophilus S 11 0 1422 Bacillus subtilis S 11 0 1423 Bacillus thuringiensis S 11 0 1428 Bacterial sp.
Details Hits: 0 Votes: 0 Ratings: Reviews: Google PR: Prom : ELECTROPORATION AND ELECTROFUSION IN CELL BIOLOG Y Edited by Eberhard Neumann, Arthur E . Sowers , and Carol A . Jordan (Plenum Publishing Corporation, 1989) Chapter 22 Plant Gene Transfer Using Electrofusion an d Electroporation James A . Saunders, Benjamin F . Matthews, and Paul D .
Details Hits: 0 Votes: 0 Ratings: Reviews: Google PR: 18. R: DNA yield.
Many thanks to those who have answered to my request on DNA yield. To quantify DNA concentration I use ethidium fluorescence comparison on the gel, since OD260 is not reliable when performing DNA extraction by CTAB.
Details Hits: 0 Votes: 0 Ratings: Reviews: Google PR: Allegato A alla Relazione Riassuntiva I GIUDIZI SUI CURRICULA, SUI TITOLI E SULLE PUBBLICAZIONI SCIENTIFICHE PRESENTATE CANDIDATO: Marcella Bracale Giudizi individuali: Commissario prof.
Details Hits: 0 Votes: 0 Ratings: Reviews: Google PR: R. Rao Nucleo e cromosomi n° 3 Cromosoma Eucariotico Nucleare I cromosomi sono costituiti da cromatina La cromatina è costituita: Proteine DNA RNA Proteine istoniche Proteine acide Prof R.Rao Nucleo e cromosomi n° 4 Cromatina eucromatina eterocromatina Prof. R.
Details Hits: 1 Votes: 0 Ratings: Reviews: Google PR:
