+ Main Category
+ Tell a Friend
Fill out the information below to email a friend a brief note about 'Olericulture: Vegetable Cultivation and Production'
+ Top 10
+ Directory Statistics
Links: 6601
Categories: 68
Registered Users: 120
Mailing List Subscribers: 26
+ Pagerank Statistics
+ Join Mailing List
Joining mailing list will entitle you
to receive occasional emails informing you of news and
updates to the site and any special offers that may be
of interest to you.
Web Links [Tag : nicotiana]
This page was last modified Sept. 13, 2006. A link to P450 functions in plants an extensive listing with references. From the Plant Biotechnology Institute, National Research Council, Saskatoon, Saskatchewan CANADA Plant P450s that have appeared since the 1993 P450 nomenclature update.
Details Hits: 0 Votes: 0 Ratings: 
Reviews: 
Google PR: Supplemental Table II â Top 200 ESTs LEAVES TC Leaf P(leaf) Total 32789 32789 Singleton 3777 3777 Counted 29012 29012 1 TC35585: chlorophyll a/b binding protein {Medicago sativa} 464 15.
Details Hits: 0 Votes: 0 Ratings: Reviews: Google PR: 23. dbEST Summary.
(rat) 871,163 Ciona intestinalis 686,396 Xenopus laevis (African clawed frog) 677,784 Sus scrofa (pig) 641,896 Gallus gallus (chicken) 599,330 Drosophila melanogaster (fruit fly) 532,557 Hordeum vulgare + subsp.
Details Hits: 0 Votes: 0 Ratings: Reviews: Google PR: 986 20 ACCCGAGATTGTTGGTTGAG 59.966 20 217 15 231 AGCTCAGTCCTCCACTTCCA 59.986 20 AATCGTTTGTAGCTGTCGGG 60.132 20 240 15 254 GGATTCCCAAACTCCGAAAT 60.131 20 ACCCGAGATTGTTGGTTGAG 59.966 20 140 92 231 >TA17352_4081 1 p1 (A)10 10 518 527 GGGCTTTTTGTGTAAAGGGTT 59.
Details Hits: 0 Votes: 0 Ratings: Reviews: Google PR: 25. Sem título-14.
Braz. J. Biol., 63(3): 437-448, 2003 EVOLUTION OF PATHOGENESIS-RELATED PROTEINS 437 EVOLUTIONARY IMPLICATIONS OF INTRA- AND INTERSPECIFIC MOLECULAR VARIABILITY OF PATHOGENESIS-RELATED PROTEINS FREITAS, L. B.,1 BONATTO, S. L.2 and SALZANO, F. M.
Details Hits: 0 Votes: 0 Ratings: Reviews: Google PR: cellwall.stanford.edu - Carnegie Institution of Washington - Department of Plant Biology home new download blast species summary structures trees Summary of cellwall DNA sequences by plant species Gene counts by family for each
Details Hits: 9 Votes: 0 Ratings: Reviews: Google PR: Full protein sequences are available in table format, arranged alphabetically and by location in the tree below. H3s which are known or expected to be replication-coupled (RC) are separated from H3s which are known or expected to be replication-independent (RI).
Details Hits: 0 Votes: 0 Ratings: Reviews: Google PR: 28. Review.
BIOLOGIA PLANTARUM 42 (4): 481-497, 1999 REVIEW Acclimatization of micropropagated plants to ex vitro conditions J. POSPÍ`ILOVÁ*, I. TICHÁ**, P. KADLE EK**, D. HAISEL* and `.
Details Hits: 0 Votes: 0 Ratings: Reviews: Google PR: 1 R687 0 group_1_ D23969 1 C161 0.3 group_1_ D15147 1 C602 0.6 group_1_ D15413 ribosomal protein S5 homolog Nicotiana tabacum 230 1 S1442 5.3 group_1_ D39825 1 C970 5.6 group_1_ D15622 1 S1543 5.6 group_1_ D39891 1 S10623 7 group_1_ D46151 leucyl-tRNA synthetase (EC 6.1.1.
Details Hits: 0 Votes: 0 Ratings: Reviews: Google PR: 30. dbEST Summary.
Homo sapiens (human) 7,893,983 Mus musculus + domesticus (mouse) 4,720,064 Oryza sativa (rice) 1,188,565 Zea mays (maize) 1,143,728 Bos taurus (cattle) 1,137,353 Danio rerio (zebrafish) 1,134,553 Xenopus tropicalis 1,044,182 Rattus norvegicus + sp.
Details Hits: 0 Votes: 0 Ratings: Reviews: Google PR: Full protein sequences are available in table format, arranged alphabetically and by location in the tree below. H3s which are known or expected to be replication-coupled (RC) are separated from H3s which are known or expected to be replication-independent (RI).
Details Hits: 0 Votes: 0 Ratings: Reviews: Google PR: Description of 00.057.0.01.016. Chilli veinal mottle virus, generated from ICTVdB, a DELTA database
Details Hits: 1 Votes: 0 Ratings: Reviews: Google PR: 172 22 AAAGCTCTTCATGGGAGCAA 59.955 20 228 4 231 GCGGGACACAGAACTTCTTTAC 60.172 22 GGAGCAACACCCTGAATGAT 59.934 20 215 4 218 GCGGGACACAGAACTTCTTTAC 60.172 22 ACATTTGCAGCCATTTCCTC 60.
Details Hits: 0 Votes: 0 Ratings: Reviews: Google PR: Description of 00.057.0.81.045. Indian pepper mottle virus, generated from ICTVdB, a DELTA database
Details Hits: 0 Votes: 0 Ratings: Reviews: Google PR: AC: RSP00001//OS: tomato (Lycopersicon esculentum) /GENE: pds/RE: Pds/Le element /BF: unknown nuclear factor 2. AC: RSP00002//OS: Brassica napus /GENE: Oleosin/RE: ABRE-3 /BF: B.napus embryo protein factor 3.
Details Hits: 1 Votes: 0 Ratings: Reviews: Google PR: Solanaceae Browallia Browallia americana L. Jamaican forget me not MA Calibrachoa Calibrachoa parviflora (Juss.) D'Arcy seaside petunia ME NH MA CT RI Capsicum Capsicum annuum L. cayenne pepper CT Datura Datura inoxia P. Mill. pricklyburr ME NH VT MA CT RI Datura stramonium L.
Details Hits: 0 Votes: 0 Ratings: Reviews: Google PR: Pages: [< Previous] 1 2
