Browse by Tag: protein

ADD A LISTING

+ Main Category

Crops: 6289

Biology: 170

Research: 792

Business: 41

Home Gardening: 101

+ Tell a Friend

Fill out the information below to email a friend a brief note about 'Olericulture: Vegetable Cultivation and Production'

+ Top 10

Pomology: Fruit Cultivation and Production

TropHort: Biology, Agriculture, Horticulture and Forestry

Producing Vegetable Crops 5th Edition by John M. Swiader.

Broccoli.

Asparagus - Wikipedia, the free encyclopedia

Microsoft Word - Bell pepper lesson.doc.

Texas A&M University System Research & Extension Center at Stephenville - Horticulture.

Veg&Fruit2007:Layout 1.

Life and Earth Sciences Social Network

Alleviating malnutrition through agriculture in Bangladesh.

+ Directory Statistics

Links: 6601
Categories: 68
Registered Users: 119
Mailing List Subscribers: 26

+ Pagerank Statistics

PR 9

1 site(s)

PR 7

3 site(s)

PR 6

28 site(s)

PR 5

186 site(s)

PR 4

595 site(s)

PR 3

879 site(s)

PR 2

508 site(s)

PR 1

235 site(s)

+ Join Mailing List

Joining mailing list will entitle you to receive occasional emails informing you of news and updates to the site and any special offers that may be of interest to you.

Web Links [Tag : protein]

101. a2m2html output for file tmp.a2m.

Details Hits: 0 Votes: 0 Ratings:

Reviews:

Google PR:

102. ONS Publications - Oncology Nursing Forum.

To provide evidence-based research information about 47 herbs and natural products that have the potential to protect against the development of cancer. Data Sources: Natural Medicines Comprehensive Database and Lawrence Review of Natural Products-Monograph System.

Details Hits: 0 Votes: 0 Ratings:

Reviews:

Google PR:

103. ID SSR nr. SSR type SSR size start end FORWARD PRIMER1 (5'-3') Tm(°C)...

986 20 ACCCGAGATTGTTGGTTGAG 59.966 20 217 15 231 AGCTCAGTCCTCCACTTCCA 59.986 20 AATCGTTTGTAGCTGTCGGG 60.132 20 240 15 254 GGATTCCCAAACTCCGAAAT 60.131 20 ACCCGAGATTGTTGGTTGAG 59.966 20 140 92 231 >TA17352_4081 1 p1 (A)10 10 518 527 GGGCTTTTTGTGTAAAGGGTT 59.

Details Hits: 0 Votes: 0 Ratings:

Reviews:

Google PR:

104. Name.

Name GenBank AC Category Similarity Species Blast AC E value Seq quality Sma/Eco site polyA Seq length cDNA length rA05 BI978233 N No hits found y y 376 600 rA06 BI978234 N No hits found y n 722 1100 rA07 BI978235 U not annotated Arabidopsis thaliana AB006697 7,00E-05 y n 460 800 rA08 BI978236 N No

Details Hits: 0 Votes: 0 Ratings:

Reviews:

Google PR:

105. BLAST Search Results.

Blast performed on April-8-2007 BLASTP 2.2.13 [Nov-27-2005] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J.

Details Hits: 0 Votes: 0 Ratings:

Reviews:

Google PR:

106. International union of pure and applied chemistry.

PROPERTIES AND UNITS IN CLINICAL ALLERGOLOGY (Technical report) (IUPAC-IFCC 1999) Prepared for publication by Ivan Bruunshuus1, Lars K.

Details Hits: 0 Votes: 0 Ratings:

Reviews:

Google PR:

107. GiardiaDB.

Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402.

Details Hits: 1 Votes: 0 Ratings:

Reviews:

Google PR:

108. 6808jonsson.

Publication of a translation into another language is subject to the additional condition of prior approval from the relevant IUPAC National Adhering Organization.

Details Hits: 0 Votes: 0 Ratings:

Reviews:

Google PR:

109. Glb3_lamsp|1.1.1|167#169#|giant hemoglobin aiii chain -...

GLB3_LAMSP|1.1.1|167#169#|GIANT HEMOGLOBIN AIII CHAIN - LAMELLIBRACHIA SP. (DEEP-SEA GIANT TUBE WORM) GLB1_CALSO|1.1.1|167#|GLOBIN I (HB I) - CALYPTOGENA SOYOAE (DEEP-SEA COLD-SEEP CLAM) GLB1_PHESE|1.1.1|167#|GLOBIN I, EXTRACELLULAR (ERYTHROCRUORIN) - PHERETIMA SIEBOLDI (EARTHWORM) GLB2_CALSO|1.1.

Details Hits: 0 Votes: 0 Ratings:

Reviews:

Google PR:

110. Biochem. J. (2006) 400, 99-104 - P. Ghosh and J.K. Batra - Differential catalytic activity of saporins 5 and 6.

Saporin, a type I ribosome-inactivating protein produced by the soapwort plant Saponaria officinalis belongs to a multigene family that encodes its several isoforms.

Details Hits: 0 Votes: 0 Ratings:

Reviews:

Google PR:

111. Probe Set AGI Data Source Criterion for Match TIGR Description...

Probe Set AGI Data Source Criterion for Match TIGR Description 13254_at AT4G17190 TIGR ATH1.seq 100 percent over >= 50 bp, unique. farnesyl pyrophosphate synthetase 2 (FPS2) [farnesyl diphosphate synthase 2] / identical to GB:46350; supported by cDNA: gi_1146162_gb_L46349.

Details Hits: 0 Votes: 0 Ratings:

Reviews:

Google PR:

112. Defense-related genes.

Hypersensitive Response cysteine proteinase (EC 3.4.22.-) 3 precursor-kidney bean Hypersensitive Response cysteine proteinase (EC 3.4.22.-) precursor - spring vetch Hypersensitive Response cysteine proteinase (EC 3.4.22.-) F23E12.

Details Hits: 0 Votes: 0 Ratings:

Reviews:

Google PR:

113. 1 R687 0 group_1_ D23969 1 C161 0.3 group_1_ D15147 1 C602 0.6...

1 R687 0 group_1_ D23969 1 C161 0.3 group_1_ D15147 1 C602 0.6 group_1_ D15413 ribosomal protein S5 homolog Nicotiana tabacum 230 1 S1442 5.3 group_1_ D39825 1 C970 5.6 group_1_ D15622 1 S1543 5.6 group_1_ D39891 1 S10623 7 group_1_ D46151 leucyl-tRNA synthetase (EC 6.1.1.

Details Hits: 0 Votes: 0 Ratings:

Reviews:

Google PR:

114. array_element_name array_element_type organism is_control locus...

array_element_name array_element_type organism is_control locus description is_ambiguous chromosome start stop 18001_at oligonucleotide Arabidopsis thaliana no AT1G01040 DEAD/DEAH box helicase carpel factory / CAF identical to RNA helicase/RNAseIII CAF protein GB:AAF03534 GI:6102610 from

Details Hits: 0 Votes: 0 Ratings:

Reviews:

Google PR:

115. Lends.

BLASTP 2.0.10 [Aug-26-1999] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402.

Details Hits: 0 Votes: 0 Ratings:

Reviews:

Google PR:

116. Ncrassa_annotations.

7nc225_030@LGVII:7nc225 malate synthase, glyoxysomal PIR:S17774 malate synthase (EC 4.1.3.2) - Neurospora crassa 996 0.0 PIR:S17773 malate synthase (EC 4.1.3.2) - Emericella nidulans 914 0.0 TRCDSEMBL:AF222907_1 gene: "MLS1"; product: "malate synthase"; ... 697 0.0 PIR:JX0196 malate synthase (EC 4.

Details Hits: 0 Votes: 0 Ratings:

Reviews:

Google PR:

117. GEISHA BLASTX report for 06J_T7.

gi|18265391|gb|AAL67159.1|AF323993_1 histone H3.3 [Trichinella p... 263 2e-69 gi|17567723|ref|NP_509344.1| Core histone H2A/H2B/H3/H4 (15.3 kD... 263 2e-69 gi|12847552|dbj|BAB27616.1| unnamed protein product [Mus musculus] 191 2e-69 gi|27718971|ref|XP_235304.1| similar to H3 histone, family 3B [R...

Details Hits: 0 Votes: 0 Ratings:

Reviews:

Google PR:

118. Homopeptide Repeats Database.

>gi|119503|sp| P03384| ENV_WMSV Envelope glycoprotein (Env polyprotein) [Contains: Transmembrane protein (Envelope protein p15E); R-peptide (p2E)] >gi| 1335598| emb| CAA24517.

Details Hits: 0 Votes: 0 Ratings:

Reviews:

Google PR:

119. Immunologie: 3. Jahr.

Das Immunsystem eine Dimension höher als Genomics Beda M. Stadler Institute of Immunology Inselspital Bern, Switzerland Folie 2 SILAMED 2003 Das Immunsystem: Einführung Abwehr Unterscheidung fremd/eigen Unspezifisches oder Angeborenes Immunsystem. Spezifisches oder adaptives Immunsystem.

Details Hits: 0 Votes: 0 Ratings:

Reviews:

Google PR:

120. BLAST Search Results.

BLASTX 2.2.4 [Aug-26-2002] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402.

Details Hits: 0 Votes: 0 Ratings:

Reviews:

Google PR:

Pages: [<< First] [< Previous] 2 3 4 5 6 7 8 9 [Next >]