+ Main Category
+ Tell a Friend
Fill out the information below to email a friend a brief note about 'Olericulture: Vegetable Cultivation and Production'
+ Top 10
+ Directory Statistics
Links: 6598
Categories: 68
Registered Users: 104
Mailing List Subscribers: 25
+ Pagerank Statistics
+ Join Mailing List
Joining mailing list will entitle you
to receive occasional emails informing you of news and
updates to the site and any special offers that may be
of interest to you.
Web Links [Tag : putative]
{Lycopersicon esculentum;} ^|^PIR|S42542|S42542 ripening-associated membrane protein (clone pNY507) - tomato {Lycopersicon esc-TRUNCATED- 1 p1 (A)12 12 161 172 CCACTATAAAACAACCACAACCC 59.569 23 GACAACTCCCCTGGTTCAAA 59.943 20 254 79 332 CCACTATAAAACAACCACAACCC 59.
Details Hits: 0 Votes: 0 Ratings: 
Reviews: 
Google PR: Probe Set AGI Data Source Criterion for Match TIGR Description 13254_at AT4G17190 TIGR ATH1.seq 100 percent over >= 50 bp, unique. farnesyl pyrophosphate synthetase 2 (FPS2) [farnesyl diphosphate synthase 2] / identical to GB:46350; supported by cDNA: gi_1146162_gb_L46349.
Details Hits: 0 Votes: 0 Ratings: Reviews: Google PR: This list last updated July 19, 2002 Note: Assembly 1 was done on Jan 29, 2001. Assembly 2 was done on April 1, 2002. \N indicates that the EST is a singleton.
Details Hits: 0 Votes: 0 Ratings: Reviews: Google PR: ID AJ890364 preliminary; circular genomic DNA; VRL; 407339 BP. XX AC AJ890364; XX SV AJ890364.1 XX DT 16-MAR-2005 (Rel. 83, Created) DT 16-MAR-2005 (Rel. 83, Last updated, Version 0) XX DE Emiliania huxleyi virus isolate EhV86 XX KW complete genome.
Details Hits: 0 Votes: 0 Ratings: Reviews: Google PR: Probe Set AGI Data Source Criterion for Match TIGR Description 13254_at AT4G17190 TIGR ATH1.seq 100 percent over >= 50 bp, unique. farnesyl pyrophosphate synthetase 2 (FPS2) [farnesyl diphosphate synthase 2] / identical to GB:46350; supported by cDNA: gi_1146162_gb_L46349.
Details Hits: 0 Votes: 0 Ratings: Reviews: Google PR: Analysis of UV spectra using partial least-squares analysis and multivariate regression modeling techniques can reveal the heat locked within red hot chilli peppers.
Details Hits: 0 Votes: 0 Ratings: Reviews: Google PR: We have generated a collection of Dissociation (Ds) transposon lines with insertions on all 5 Arabidopsis chromosomes. Here we report the insertion sites in 260 independent single-transposon lines, derived from four different Ds donor sites.
Details Hits: 1 Votes: 0 Ratings: Reviews: Google PR:
