Browse by Tag: sativa

ADD A LISTING

+ Main Category

Crops: 6288

Biology: 168

Research: 792

Business: 40

Home Gardening: 100

+ Tell a Friend

Fill out the information below to email a friend a brief note about 'Olericulture: Vegetable Cultivation and Production'

+ Top 10

Pomology: Fruit Cultivation and Production

TropHort: Biology, Agriculture, Horticulture and Forestry

Producing Vegetable Crops 5th Edition by John M. Swiader.

Asparagus - Wikipedia, the free encyclopedia

Broccoli.

Microsoft Word - Bell pepper lesson.doc.

Texas A&M University System Research & Extension Center at Stephenville - Horticulture.

Veg&Fruit2007:Layout 1.

Alleviating malnutrition through agriculture in Bangladesh.

Life and Earth Sciences Social Network

+ Directory Statistics

Links: 6598
Categories: 68
Registered Users: 104
Mailing List Subscribers: 25

+ Pagerank Statistics

PR 7

2 site(s)

PR 6

27 site(s)

PR 5

178 site(s)

PR 4

620 site(s)

PR 3

872 site(s)

PR 2

510 site(s)

PR 1

200 site(s)

+ Join Mailing List

Joining mailing list will entitle you to receive occasional emails informing you of news and updates to the site and any special offers that may be of interest to you.

Web Links [Tag : sativa]

81. Åbo akademi institutionen för biologi fordringar i växtkännedom för...

ÅBO AKADEMI INSTITUTIONEN FÖR BIOLOGI FORDRINGAR I VÄXTKÄNNEDOM FÖR BIOLOGILÄRARE B. TRÄDGÅRDSVÄXTER OLOF RÖNNBERG 1995 1 FORDRINGARNA I VÄXTKÄNNEDOM FÖR BIOLOGILÄRARE (LINJE C) B.

Details Hits: 0 Votes: 0 Ratings:

Reviews:

Google PR:

82. LDEF Materials - Category: Seed.

14 and Tennessee Green Pod Material, Composition: NULL Material, Remarks: Cov Reference: No value in DB Category: Seed Experiment Number: M0006 - Space Environment Effects Associated Tray(s): Tray Location: C02 - Orientation: 141.

Details Hits: 0 Votes: 0 Ratings:

Reviews:

Google PR:

83. Arabidopsis thaliana.

Indica 419 - 463 Oryza sativa ssp. Javanica 424 Citrullus vulgaris (= lanatus) 425 - 434 Mangifera indica 439 Ananas bracteatus 444 Cucumis melo 454 - 502 Medicago truncatula 454 - 526 Trifolium pratense 468 Brassica nigra 468 Brassica campestris ssp.

Details Hits: 0 Votes: 0 Ratings:

Reviews:

Google PR:

84. ID SSR nr. SSR type SSR size start end FORWARD PRIMER1 (5'-3') Tm(°C)...

986 20 ACCCGAGATTGTTGGTTGAG 59.966 20 217 15 231 AGCTCAGTCCTCCACTTCCA 59.986 20 AATCGTTTGTAGCTGTCGGG 60.132 20 240 15 254 GGATTCCCAAACTCCGAAAT 60.131 20 ACCCGAGATTGTTGGTTGAG 59.966 20 140 92 231 >TA17352_4081 1 p1 (A)10 10 518 527 GGGCTTTTTGTGTAAAGGGTT 59.

Details Hits: 0 Votes: 0 Ratings:

Reviews:

Google PR:

85. Name.

Name GenBank AC Category Similarity Species Blast AC E value Seq quality Sma/Eco site polyA Seq length cDNA length rA05 BI978233 N No hits found y y 376 600 rA06 BI978234 N No hits found y n 722 1100 rA07 BI978235 U not annotated Arabidopsis thaliana AB006697 7,00E-05 y n 460 800 rA08 BI978236 N No

Details Hits: 0 Votes: 0 Ratings:

Reviews:

Google PR:

86. SWBIC - Batch BLAST results.

BLASTX 2.2.2 [Dec-14-2001] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402.

Details Hits: 1 Votes: 0 Ratings:

Reviews:

Google PR:

87. European and Mediterranean Plant Protection Organisation.

) Pest risk analyst: EPPO Secretariat Draft 07 March 2006 (editorial modifications by EPPO Secretariat in 2006-07) Stage 1: Initiation 1 What is the reason for performing the PRA? Identification of a single pest Solanum elaeagnifolium has been declared as an invasive plant in many countries.

Details Hits: 0 Votes: 0 Ratings:

Reviews:

Google PR:

88. Microsoft Word - Klein_Appendix1_revised.DOC.

Fig. 1: The FAO lists several commodities that derive from one crop species. We pooled these commodities by species, for example pop corn, green corn, and maize all derive from Zea mais. Some crops are listed in more than one commodity, pooled with commodity crops.

Details Hits: 0 Votes: 0 Ratings:

Reviews:

Google PR:

89. Gynecological Herbs.

introduction: Traditionally, a large number of different herbs have been used to affect different aspects of the activity of the female reproductive tract.

Details Hits: 1 Votes: 0 Ratings:

Reviews:

Google PR:

90. 3. Atculos 4.

INTRODUCCIÓN El agua es el refrigerante más utilizado en las plantas productoras de energía para disipar el exce- so de energía calorífica. La cantidad de calor que tiene que disiparse depende de la eficiencia de la planta, pero, en general, se estiman eficiencias del orden del 50 %.

Details Hits: 0 Votes: 0 Ratings:

Reviews:

Google PR:

91. DFCI - OnGI EST Annotator.

API61AA451580AA451580 nbspsimilar to GP|4038717|dbj|BAA35175.1||AB020956 ribulose-1,5-bisphosphate carboxylase/oxygenase small subunit {Triticum turgidum subsp.

Details Hits: 0 Votes: 0 Ratings:

Reviews:

Google PR:

92. Defense-related genes.

Hypersensitive Response cysteine proteinase (EC 3.4.22.-) 3 precursor-kidney bean Hypersensitive Response cysteine proteinase (EC 3.4.22.-) precursor - spring vetch Hypersensitive Response cysteine proteinase (EC 3.4.22.-) F23E12.

Details Hits: 0 Votes: 0 Ratings:

Reviews:

Google PR:

93. 1 R687 0 group_1_ D23969 1 C161 0.3 group_1_ D15147 1 C602 0.6...

1 R687 0 group_1_ D23969 1 C161 0.3 group_1_ D15147 1 C602 0.6 group_1_ D15413 ribosomal protein S5 homolog Nicotiana tabacum 230 1 S1442 5.3 group_1_ D39825 1 C970 5.6 group_1_ D15622 1 S1543 5.6 group_1_ D39891 1 S10623 7 group_1_ D46151 leucyl-tRNA synthetase (EC 6.1.1.

Details Hits: 0 Votes: 0 Ratings:

Reviews:

Google PR:

94. AGROTHESAURUS Part 4 / AGROTEZAVER 4. del.

ve
jezi
ni tezaver/tezavri, geslovnik/geslovniki, geselnik/geselniki, slovar/slovarji, glosar/glosarji, besednjak/besednjaki, terminologija, klasifikacija, kmetijstvo, biotehnika

Details Hits: 0 Votes: 0 Ratings:

Reviews:

Google PR:

95. Lends.

BLASTP 2.0.10 [Aug-26-1999] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402.

Details Hits: 0 Votes: 0 Ratings:

Reviews:

Google PR:

96. Seed ID Workshop.

Rubus spp. Rudbeckia hirta Rumex acetosa Rumex acetosella Rumex altissimus Rumex crispus Rumex maritimus var. persicarioides Rumex obtusifolius Rumex stenophyllus Salsola australis Salsola paulsenii Salsola pestifer Salvia officinallis Sarcobatus vermiculatus Schizachyrium scoparium Scirpus spp.

Details Hits: 0 Votes: 0 Ratings:

Reviews:

Google PR:

97. untitled.

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 A B C D E F G H I 21 Raphanus sativus Radish D'avignon www.johnnyseeds.com 620 mini $2.45 DS 26 Raphanus sativus Radish Cherriette www.johnnyseeds.com 2145 mini $2.

Details Hits: 0 Votes: 0 Ratings:

Reviews:

Google PR:

98. Gtr-694.

BSTRACT Alaska has remained relatively unaffected by non-native plants; however, recently the state has started to experience an influx of invasive non-native plants that the rest of the U.S. underwent 60100 years ago.

Details Hits: 0 Votes: 0 Ratings:

Reviews:

Google PR:

99. dbEST Summary.

Homo sapiens (human) 7,893,983 Mus musculus + domesticus (mouse) 4,720,064 Oryza sativa (rice) 1,188,565 Zea mays (maize) 1,143,728 Bos taurus (cattle) 1,137,353 Danio rerio (zebrafish) 1,134,553 Xenopus tropicalis 1,044,182 Rattus norvegicus + sp.

Details Hits: 0 Votes: 0 Ratings:

Reviews:

Google PR:

100. BLAST Search Results.

BLASTX 2.2.4 [Aug-26-2002] Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schäffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402.

Details Hits: 0 Votes: 0 Ratings:

Reviews:

Google PR:

Pages: [< Previous] 1 2 3 4 5 6 7 [Next >]