+ Main Category
+ Tell a Friend
Fill out the information below to email a friend a brief note about 'Olericulture: Vegetable Cultivation and Production'
+ Top 10
+ Directory Statistics
Links: 6601
Categories: 68
Registered Users: 120
Mailing List Subscribers: 26
+ Pagerank Statistics
+ Join Mailing List
Joining mailing list will entitle you
to receive occasional emails informing you of news and
updates to the site and any special offers that may be
of interest to you.
Web Links [Tag : solanum]
Maximum accumulation of Pin m III protein in western white pine (Pinus monticola Dougl. ex D. Don) needles occurred during the winter months. To characterize Pin m III, an expression cDNA library from poly(A)+ mRNA of needles was immunoscreened and the full length cDNA was cloned.
Details Hits: 0 Votes: 0 Ratings: 
Reviews: 
Google PR: 22. aster3.
Aster, Beta vulgaris var. saccharifera (Remolacha), Brassica juncea (indian mustard), Brassica oleracea var. acephala (Col forrajera), Brassica rapa ssp.
Details Hits: 0 Votes: 0 Ratings: Reviews: Google PR: Aelia acuminata (Linnaeus) Asteraceae Calendula persica (Hoberlandt, 1953) Betulaceae Betula sp. (Derjanschi & Péricart, 2005) Corylus sp. (Derjanschi & Péricart, 2005) Chenopodiaceae Atriplex rosea (Ribes et al., 1997) Suaeda vera (Ribes et al.
Details Hits: 0 Votes: 0 Ratings: Reviews: Google PR: Received for publication October 31, 2005. The fate of cadmium in soils is governed by spatially heterogeneous processes that proceed from decades to centuries. This study aimed at modeling the fate of Cd within the wastewater irrigation area (WIA) of Braunschweig (Germany).
Details Hits: 0 Votes: 0 Ratings: Reviews: Google PR: 25. dbEST Summary.
(rat) 871,163 Ciona intestinalis 686,396 Xenopus laevis (African clawed frog) 677,784 Sus scrofa (pig) 641,896 Gallus gallus (chicken) 599,330 Drosophila melanogaster (fruit fly) 532,557 Hordeum vulgare + subsp.
Details Hits: 0 Votes: 0 Ratings: Reviews: Google PR: wilkesiana Acanthospermum australe Acanthospermum hispidum Achyranthes aspera var. X aspera Achyranthes aspera var.
Details Hits: 1 Votes: 0 Ratings: Reviews: Google PR: Veilleux, Chairman ____________________________ ___________________________ Eric Beers Elizabeth A. Grabau __________________________________ ________________________________ Carl Griffey M. A.
Details Hits: 0 Votes: 0 Ratings: Reviews: Google PR: 28. rgang 19, nr.
Ĺrgang 25, nr. 1 15. Januar 2006 side 1 - 19 MEDDELELSER ......................................................................................................................... 1 Official Notites I ANMELDELSER TIL PLANTENYHEDSBESKYTTELSE og/eller OPTAGELSE PĹ SORTSLISTE .........................
Details Hits: 0 Votes: 0 Ratings: Reviews: Google PR: Basilic ( Ocimum basilicum L. ) Nana ordinaire ( Mentha sp. ) Nana menthe ( Mentha sp. ) Chou cabus vert ( Brassica oleracea L. var. capitata ) Piment ( Capsicum frutescens L. ) Poivron ( Capsicum annuum L. ) Bissap ( Hibiscus sabdariffa L. ) Laitue ( Lactuca sativa L. ) Courgette ( Cucumis pepo L.
Details Hits: 0 Votes: 0 Ratings: Reviews: Google PR: --------------------------------------------------- Crops featuring in TropCrop and the modules in which they occur (always with photos!
Details Hits: 1 Votes: 0 Ratings: Reviews: Google PR: Indica 419 - 463 Oryza sativa ssp. Javanica 424 Citrullus vulgaris (= lanatus) 425 - 434 Mangifera indica 439 Ananas bracteatus 444 Cucumis melo 454 - 502 Medicago truncatula 454 - 526 Trifolium pratense 468 Brassica nigra 468 Brassica campestris ssp.
Details Hits: 0 Votes: 0 Ratings: Reviews: Google PR: 986 20 ACCCGAGATTGTTGGTTGAG 59.966 20 217 15 231 AGCTCAGTCCTCCACTTCCA 59.986 20 AATCGTTTGTAGCTGTCGGG 60.132 20 240 15 254 GGATTCCCAAACTCCGAAAT 60.131 20 ACCCGAGATTGTTGGTTGAG 59.966 20 140 92 231 >TA17352_4081 1 p1 (A)10 10 518 527 GGGCTTTTTGTGTAAAGGGTT 59.
Details Hits: 0 Votes: 0 Ratings: Reviews: Google PR: 33. Sem título-14.
Braz. J. Biol., 63(3): 437-448, 2003 EVOLUTION OF PATHOGENESIS-RELATED PROTEINS 437 EVOLUTIONARY IMPLICATIONS OF INTRA- AND INTERSPECIFIC MOLECULAR VARIABILITY OF PATHOGENESIS-RELATED PROTEINS FREITAS, L. B.,1 BONATTO, S. L.2 and SALZANO, F. M.
Details Hits: 0 Votes: 0 Ratings: Reviews: Google PR: ) Pest risk analyst: EPPO Secretariat Draft 07 March 2006 (editorial modifications by EPPO Secretariat in 2006-07) Stage 1: Initiation 1 What is the reason for performing the PRA? Identification of a single pest Solanum elaeagnifolium has been declared as an invasive plant in many countries.
Details Hits: 0 Votes: 0 Ratings: Reviews: Google PR: 35. 4.
2. Nebraska estimates economic losses due to nightshade infestations of bean fields alone to have reached at 12% of total income (Burget et al, 1973). D. Importance to Humans 1. Blacknightshade used as a vegetable in China, Russia, Africa, and elsewhere around the world. 2.
Details Hits: 0 Votes: 0 Ratings: Reviews: Google PR: Fig. 1: The FAO lists several commodities that derive from one crop species. We pooled these commodities by species, for example pop corn, green corn, and maize all derive from Zea mais. Some crops are listed in more than one commodity, pooled with commodity crops.
Details Hits: 2 Votes: 0 Ratings: Reviews: Google PR: Full protein sequences are available in table format, arranged alphabetically and by location in the tree below. H3s which are known or expected to be replication-coupled (RC) are separated from H3s which are known or expected to be replication-independent (RI).
Details Hits: 0 Votes: 0 Ratings: Reviews: Google PR: AP Technical Agency Draft Page D-1 Appendix D. Exotic Plant Species Reported from the South Florida Ecosystem. Community types are indicated where known.
Details Hits: 1 Votes: 0 Ratings: Reviews: Google PR: 39. dbEST Summary.
japonicus 111,459 Salmo salar 91,491 Ciona savignyi 84,302 Physcomitrella patens subsp.
Details Hits: 0 Votes: 0 Ratings: Reviews: Google PR: The hosts recorded with damaging populations of the pink mealybug are denoted with a number before the scientific name. They may or may not be economic hosts.
Details Hits: 0 Votes: 0 Ratings: Reviews: Google PR: Pages: [< Previous] 1 2 3 4 [Next >]
