Home India Indonesia Taiwan Kenya Thailand Vietnam
New Listings     Hot Listings     Top Rated     Editor Pick     Add a Listing      Upgrade a Listing     Update a Listing     Get Rated     Suggest a Category     Contact
+ Main Category

Crops: 6288
Biology: 168

+ Tell a Friend

Fill out the information below to email a friend a brief note about 'Olericulture: Vegetable Cultivation and Production'

Your Name:
     
Your Email:
     
Friend's Name:
     
Friend's Email:
     

     


+ Top 10


+ Directory Statistics


Links: 6600
Categories: 68
Registered Users: 108
Mailing List Subscribers: 25

+ Pagerank Statistics

PR 7
2 site(s)
PR 6
28 site(s)
PR 5
174 site(s)
PR 4
612 site(s)
PR 3
857 site(s)
PR 2
530 site(s)
PR 1
200 site(s)

+ Join Mailing List

Joining mailing list will entitle you to receive occasional emails informing you of news and updates to the site and any special offers that may be of interest to you.




Web Links [Tag : tabacum]


Sort By :
This review offers a brief overview of the field of microbial and plant biocatalysts, discusses the studies thus far on the use of intact plant materials for conducting synthetic chemical reactions, and considers some opportunities for future development.
Details Hits: 0 Votes: 0 Ratings: Reviews: Google PR:

00: gb|AAM81202.1| calmodulin 1 [Medicago truncatula] gb|AAD53313.1| calmodulin 7 [Arabidopsis thaliana] emb|CAH57707.1| calmodulin [Quercus petraea] gb|AAM66013.1| calmodulin 7 [Arabidopsis thaliana] emb|CAA43143.1| Calmodulin [Malus x domestica] emb|CAB83153.
Details Hits: 0 Votes: 0 Ratings: Reviews: Google PR:

Query sequence: S39K5 (611 letters) Database: ./db/nr 2,304,535 sequences; 784,226,776 total letters Searching..................................................done Score E Sequences producing significant alignments: (bits) Value gb|AAM81202.1| calmodulin 1 [Medicago truncatula] >gi|5825598|gb...
Details Hits: 0 Votes: 0 Ratings: Reviews: Google PR:

{Lycopersicon esculentum;} ^|^PIR|S42542|S42542 ripening-associated membrane protein (clone pNY507) - tomato {Lycopersicon esc-TRUNCATED- 1 p1 (A)12 12 161 172 CCACTATAAAACAACCACAACCC 59.569 23 GACAACTCCCCTGGTTCAAA 59.943 20 254 79 332 CCACTATAAAACAACCACAACCC 59.
Details Hits: 0 Votes: 0 Ratings: Reviews: Google PR:

103e-277 T20O9TF : Page 1 of HTML SIMILAR TO: gi|2351072|dbj|AB006707|AB006707 Arabidopsis thaliana genomicDNA, chromosome 5, P1 clone: MYC6 PVALUE: 6.
Details Hits: 0 Votes: 0 Ratings: Reviews: Google PR:

AC: RSP00001//OS: tomato (Lycopersicon esculentum) /GENE: pds/RE: Pds/Le element /BF: unknown nuclear factor 2. AC: RSP00002//OS: Brassica napus /GENE: Oleosin/RE: ABRE-3 /BF: B.napus embryo protein factor 3.
Details Hits: 0 Votes: 0 Ratings: Reviews: Google PR:

R. Rao Nucleo e cromosomi n° 3 Cromosoma Eucariotico Nucleare I cromosomi sono costituiti da cromatina La cromatina è costituita: Proteine DNA RNA Proteine istoniche Proteine acide Prof R.Rao Nucleo e cromosomi n° 4 Cromatina eucromatina eterocromatina Prof. R.
Details Hits: 1 Votes: 0 Ratings: Reviews: Google PR:

This page was last modified Sept. 13, 2006. A link to P450 functions in plants an extensive listing with references. From the Plant Biotechnology Institute, National Research Council, Saskatoon, Saskatchewan CANADA Plant P450s that have appeared since the 1993 P450 nomenclature update.
Details Hits: 0 Votes: 0 Ratings: Reviews: Google PR:

Supplemental Table II â Top 200 ESTs LEAVES TC Leaf P(leaf) Total 32789 32789 Singleton 3777 3777 Counted 29012 29012 1 TC35585: chlorophyll a/b binding protein {Medicago sativa} 464 15.
Details Hits: 0 Votes: 0 Ratings: Reviews: Google PR:

986 20 ACCCGAGATTGTTGGTTGAG 59.966 20 217 15 231 AGCTCAGTCCTCCACTTCCA 59.986 20 AATCGTTTGTAGCTGTCGGG 60.132 20 240 15 254 GGATTCCCAAACTCCGAAAT 60.131 20 ACCCGAGATTGTTGGTTGAG 59.966 20 140 92 231 >TA17352_4081 1 p1 (A)10 10 518 527 GGGCTTTTTGTGTAAAGGGTT 59.
Details Hits: 0 Votes: 0 Ratings: Reviews: Google PR:

BIOLOGIA PLANTARUM 42 (4): 481-497, 1999 REVIEW Acclimatization of micropropagated plants to ex vitro conditions J. POSPÍ`ILOVÁ*, I. TICHÁ**, P. KADLE EK**, D. HAISEL* and `.
Details Hits: 0 Votes: 0 Ratings: Reviews: Google PR:

1 R687 0 group_1_ D23969 1 C161 0.3 group_1_ D15147 1 C602 0.6 group_1_ D15413 ribosomal protein S5 homolog Nicotiana tabacum 230 1 S1442 5.3 group_1_ D39825 1 C970 5.6 group_1_ D15622 1 S1543 5.6 group_1_ D39891 1 S10623 7 group_1_ D46151 leucyl-tRNA synthetase (EC 6.1.1.
Details Hits: 0 Votes: 0 Ratings: Reviews: Google PR:

172 22 AAAGCTCTTCATGGGAGCAA 59.955 20 228 4 231 GCGGGACACAGAACTTCTTTAC 60.172 22 GGAGCAACACCCTGAATGAT 59.934 20 215 4 218 GCGGGACACAGAACTTCTTTAC 60.172 22 ACATTTGCAGCCATTTCCTC 60.
Details Hits: 0 Votes: 0 Ratings: Reviews: Google PR:

AC: RSP00001//OS: tomato (Lycopersicon esculentum) /GENE: pds/RE: Pds/Le element /BF: unknown nuclear factor 2. AC: RSP00002//OS: Brassica napus /GENE: Oleosin/RE: ABRE-3 /BF: B.napus embryo protein factor 3.
Details Hits: 1 Votes: 0 Ratings: Reviews: Google PR:



Valid XHTML 1.0 Transitional   Valid CSS